User Guide

RVMT enables researchers to explore a wide range of data from the global RNA virome. The user guide provides a brief overview of the data types, access methods, and

Download the data set

The data are available for download in several methods:

• From the NERSC's FTP server, using this site a portal to download specific subsets of the data, by slicing to specific taxonomic lineages.
• From the RVMT Zenodo's archive (doi:10.5281/zenodo.6091356). Generally, the Zeonodo deposit is more updated and comprehensive than the download portal.

The FTP server offers the data pre-segmented at each taxonomic level. If you want to use a command line, we offer a cURL generator that will generate a command for you to execute.

Alternatively, you can retrieve the data (for all data types) directly from the NERSC FTP server from the download panel. This approach pulls a zip file containing all the data for a selected taxon. Should you need only a specific file, you can download it directly by choosing a taxon and then clicking "browse FTP".

If the FTP server is down, you can also download the data from Zenodo's permanent archive. The data set on Zenodo is not redundant and pre-segmented at each taxonomic level due to size considerations.

FTP directory structure

Within the FTP server, the data are organized in a directory structure that mirrors the taxonomy. For each taxon, there is a directory with the taxon, and within that directory, there are subdirectories for each member taxon.

➜  Norzivirales tree -L 2
├── Atkinsviridae
│   ├── Atkinsviridae_Contigs.fasta.gz
│   ├── Atkinsviridae_HMMatches.tsv
│   ├── Atkinsviridae_IMG_Scaffold_cart.tsv
│   ├── Atkinsviridae_Info.tsv
│   ├── Atkinsviridae_subtree.newick
│   └── Atkinsviridae.zip
....

Data types

The following data types are included in the data set:

All taxa, as well the root, contain each of the above data types. The sole exception is that the root and any taxon that has one member do not contain a tree.

Sequences

The sequences are in gzipped FASTA format. Therefore, before using the data you need to decompress the FASTA file (unless your system has native gzip support). To do so, you will need a tool such as gzip or an alternative tool such as 7-zip. Decompressing with the command line gzip is as easy as running:

gunzip <file.fasta.gz>

By default, gzip will decompress the file to the same directory as the original file and then delete the compressed version. To avoid this, you can use the -k flag to prevent the deletion.

Example data

>ND_040544
GCTATGATGAAGCACCATTACGCTCGAATGTTGCAGATGATCACAGCCATAGGGAATATTAAAGCTTTATGTGCAATGAA
TTACCCAAATCTGGATACTGTAGTCATTATAAGACGATTACTGAATGTAGCGCAATCTGTTAGTAAAATAAATCCCAGTG
...
>ND_040545
ATCCTTCAACTGCTTCGGCCACAATGGCATATGAACTGTATAAGTTGTGTGATTTGGATTTTCTCAAGAAATACATAATG
AAATCTCATAACACAGAACCAGCATCTATTTCTCAATCTGAGGCCTCTAGCATCCGGAAAATATTCACAGCATTCGTTTC

Metadata

Each of contigs in the available FASTA files are listed as a row in the .tsv file, which contains the following metadata columns:

Example data

Source  RCR90   ND  Segmented   RID Note    Genetic_Code    Type.hit    Hit.s.  Full_name   RBS ANI90   AfLvl   Host_Evidence   Host    Length  BinID   Phylum  Class   Order   Family  Genus   ITS.SP.ID   Novel
3300003307  Rv4_009481  ND_299653   FALSE   46525   Rv4_009481  RN90.0012994    NC98.140726 NC95_125295 NC90_009681 NC99.262892 NA  Standard    NA  NA  3300003307_Ga0006883J46559_1007723  NA  ANI90_0028208   Lvl 0 - Megatree leaves.    NA  NA  4553    ND_299653   4553    NA  Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  NA  1031590 TRUE
3300003307  Rv4_009528  ND_299698   FALSE   46526   Rv4_009528  RN90.0013035    NC98.140769 NC95_125331 NC90_009628 NC99.262935 NA  Standard    NA  NA  3300003307_Ga0006883J46559_1029623  NA  ANI90_0028169   Lvl 0 - Megatree leaves.    NA  NA  3651    ND_299698   3651    NA  Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  NA  1031590 TRUE
3300004477  Rv4_083540  ND_300853   FALSE   46560   Rv4_021302  NA  NC98.146388 NC95_007711 NC90_039020 NC99.279419 NA  Standard    NA  NA  3300004477_Ga0068971_1566391    NA  ANI90_0019756   Lvl 2 - members of single-leaf-level ANI90 cluster  NA  NA  1290    ND_300853   1290    NA  Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  NA  1031533 TRUE

Annotations

Similarly, annotations generated by XXX are listed in a .tsv file, which contains the following metadata columns:

Example data

ND  ORFID   profile_accession   p1  p2  pL  pCoverage   score   evalue  New_Name    Analysis_Type   ali_Qcov_len    ClanID  Comment Classified  strand
ND_015762   ND_015762__1__1070..1415    NVPC.4921   1   344 345 NA  291.7   1.1e-84 RdRp_bracelet-C NVPCpl  345 NA  NA  1   +   Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  Cypovirus_14
ND_015762   ND_015762__61138_1  EF23215.1   1   368 369 0.997289972899729   498 5.1e-148    RdRp    ECOD    368 NA  NA  3   +   Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  Cypovirus_14
ND_015762   ND_015762__61138_1  EF24979.0   3   274 274 0.992700729927007   374.8   8.6e-111    RdRp_Reo-NTD    ECOD    272 NA  Reo RdRp N-terminal domain (1mukA:2-380): alpha-helical domain involved in the formation of the RNA template entry channel and access to the polymerase active site 1   +   Duplornaviricota    Resentoviricetes    Reovirales  Reoviridae  Cypovirus_14

IMG scaffold cart

This space-separated .tsv file is able to be used to generate a IMG Scaffold Cart for the data set. For information about its format, see the IMG Scaffold Cart documentation.

Example Data

Scaffold ID
3300003307 assembled Ga0006883J46559_1007723
3300003307 assembled Ga0006883J46559_1029623
3300004477 assembled Ga0068971_1566391
3300004601 assembled Ga0068934_1277308
3300004609 assembled Ga0068958_1157165

Tree

A tree is generated for each taxon using the R library castor, by prunning the megatree to tips associcated with each taxa. The trees are Newick formatted.

RdRps

For simplicity sake, we have added the RdRp sequences and some of the final cluster alignments directly to our FTPs:

• https://portal.nersc.gov/dna/microbial/prokpubs/Riboviria/RiboV1.4/Alignments/
• https://ftp.ncbi.nih.gov/pub/wolf/misc/JGI-TAU/

Another variation of the RdRps identified is available in the updated Zenodo deposit. If you have any questions, don't hesitate to contact us!

Example data

(Rv4_171101:2.865405286,(Rv4_299534:2.622437674,(Rv4_251004:2.449908314,(Rv4_034341:1.317564343,Rv4_049968:1.317564343):1.132343971):0.1725293602):0.2429676112):0.1683922588;

Getting help

If you need help, please contact the RVMT team. You can find a contact form here or reach out directly via email at urineri (at) mail.tau.ac (dot)il. We are happy to help!

Citing RVMT

The RVMT manuscript was publised in Cell. If you use data from the RVMT, please consider citing our work with the following citation:

Neri U, Wolf YI, Roux S, Camargo AP, Lee B, Kazlauskas D, Chen IM, Ivanova N, Zeigler Allen L, Paez-Espino D, Bryant DA, Bhaya D; RNA Virus Discovery Consortium, Krupovic M, Dolja VV, Kyrpides NC, Koonin EV, Gophna U. Expansion of the global RNA virome reveals diverse clades of bacteriophages. Cell. 2022 Sep 25:S0092-8674(22)01118-7. doi:10.1016/j.cell.2022.08.023.